Teaching casesA rare Japanese case with a NUT midline carcinoma in the nasal cavity: A case report with immunohistochemical and genetic analyses
Introduction
Several malignant tumors of the sinonasal tract may present with an undifferentiated morphology [6], [20]. Overall, these tumors pose significant diagnostic challenges to attending surgical pathologists, especially in cases in which a limited amount of biopsy material is available [6] and in cases that do not exhibit the typical immunohistochemical results [3]. Among these sinonasal malignant neoplasms, nuclear protein in testis (NUT) midline carcinoma (NMC) is a recently recognized entity that is characterized by a poor prognosis [1], [20].
The current recognition of the NMC entity is genetically defined by rearrangements of the NUT locus at 15q14, resulting in a fusion transcript with a member of the bromodomain-containing protein (BRD) family, usually BRD4 located on chromosome 19p13.1 [7], [10]. As NMC is a recently described tumor entity, it is still unfamiliar to most pathologists [14], [16], [20]. The histological features of tumors that have been reported as NMCs range from entirely undifferentiated carcinomas to carcinomas with prominent squamous differentiation [2], [3], [4], [10], [19]. Thus, the diagnosis of NMC simply based on morphology is difficult. Until recently, only one molecular method within the realm of diagnostic pathology, i.e., fluorescence in situ hybridization (FISH), was available for the robust demonstration of a rearrangement of the NUT gene [3], [8], [19]. Consequently, this entity has been commonly undiagnosed or misdiagnosed in clinical pathology practice, and comprehensive information, such as the correlation between the molecular features and the biological behaviors of this cancer, is limited. Since the identification of a somatic rearrangement involving the NUT gene in NMC [7], only a few reports have determined the fusion gene in clinical specimens using a direct sequencing method [7], [9], [12], [23]. NMCs are rare [1], [10], [20], and the geographic distribution of reported cases has been concentrated in the United States [1]. NMCs most often occur in the midline, including the head and neck, and the thorax [10], [20]. Although the sinonasal tract is considered a preferential site in the head and neck region, only 10 sinonasal NMCs have been documented [2], [3], [8], [13], [19], none of which were Japanese cases.
In this article, we describe a new Japanese case with NMC in the nasal cavity; the NMC was diagnosed using immunohistochemistry with a highly sensitive and specific NUT monoclonal antibody [11]. In addition, a BRD4-NUT fusion gene, as the mechanism of NUT overexpression, was defined by karyotyping as well as molecular methods, including FISH and RT-PCR direct sequencing.
Section snippets
Clinical summary
An 18-year-old woman sought medical advice because of nasal discharge containing blood accompanied by pain with a 1-month duration. A computed tomography scan performed at the time of hospitalization revealed a mass in the right nasal cavity, and maxillary and ethmoidal sinus (Fig. 1). The mass involved the ethmoid bone (Fig. 1, arrow). A biopsy was performed.
Histopathologic and immunohistochemical examination
All the tissues were fixed in 10% buffered formalin and were embedded in paraffin after routine processing, followed by sectioning and staining with hematoxylin and eosin (H&E). Immunostaining was performed using antibodies for the following antigens: CD34 class II (DAKO, Glostrup, Denmark), CD45 (DAKO), CD56 (Leica Biosystems, Newcastle, United Kingdom), CD99 (DAKO), CD138/Syndecan-1 (DAKO), c-kit (DAKO), cytokeratin AE1/AE3 (DAKO), desmin (DAKO), epithelial membrane antigen (EMA, DAKO), hCG
Direct sequencing
BRD4-NUT fusion cDNA was amplified using PCR with Phusion (New England BioLabs, Beverly, MA, USA); direct sequencing was then performed as described previously [7]. The primers BR2276F (AAGTTGATGTGATTGCCGGCTCCTC) and NUT1194R (GAGGTCTCTGGGCTTTACGCTGACG) were used [7]. Gel-purified PCR products were cycle-sequenced by the incorporation of ABI PRISM Big Dye Terminators (Perkin-Elmer, Inc., Wellesley, MA) and analyzed using an ABI 3130 sequencer (Life Science Technologies, Carlsbad, CA, USA).
Pathological findings
The small amount of biopsy material that was obtained revealed an undifferentiated neoplasm with necrosis (Fig. 3a). The tumor cells had round to oval nuclei with vesicular chromatin, prominent nucleoli, and scant cytoplasm (Fig. 3b). Frequent mitotic figures (10/5 hpf) were observed (Fig. 3b, arrow). Squamous differentiation was not identified.
Immunohistochemical staining demonstrated a strong vimentin positivity (Fig. 4a) with focal CD138 (Fig. 4b) and only spotty EMA (Fig. 4c) and cytokeratin
Treatment and follow up
The patient was transferred to another hospital to undergo chemoradiotherapy (the details of which are unknown), which resulted in the almost complete disappearance of the tumor. The patient is alive and well at 12 months after her diagnosis.
Discussion
The histologic features of NMC are, unfortunately, not pathognomonic, since the morphology is that of a poorly differentiated carcinoma with or without squamous differentiation [2], [3], [4], [10], [19]. Several malignant tumors occurring in the sinonasal tract may exhibit an undifferentiated morphology [3], [6], [20]. The differential diagnosis of these tumors includes hemato-lymphoid malignancies, melanomas, Ewing sarcoma/primitive neuroectodermal tumors, rhabdomyosarcoma, olfactory
Conflict of interest
The authors have no conflicts of interest to declare.
Acknowledgments
We appreciate the technical assistance of Ms. Kiyoko Nagura and Mr. Hisaki Igarashi.
This case was presented at the Japanese Pathological Society Chubu Meeting on July 13–14, 2013, in Nagoya.
This contribution was supported, in part, by Grants-in-Aid for the U.S.-Japan Cooperative Medical Science Program; the National Cancer Center Research and Development Fund; Grant for priority areas from the Japanese Ministry of Education, Culture, Sports, Science and Technology [221S0001]; and Grants-in-Aid
References (23)
NUT midline carcinoma
Cancer Genet. Cytogenet.
(2010)- et al.
Clinicopathologic features and long-term outcomes of NUT midline carcinoma
Clin. Cancer Res.
(2012) - et al.
NUT midline carcinomas of the sinonasal tract
Am. J. Surg. Pathol.
(2012) - et al.
Nuclear protein in testis midline carcinomas: a lethal and underrecognized entity
Arch. Pathol. Lab. Med.
(2011) - et al.
Pathologic characteristics of NUT midline carcinoma arising in the mediastinum
Am. J. Surg. Pathol.
(2012) - et al.
Selective inhibition of BET bromodomains
Nature
(2010) - et al.
Current diagnostic strategies for undifferentiated tumours of the nasal cavities and paranasal sinuses
Histopathology
(2011) - et al.
BRD4-NUT fusion oncogene: a novel mechanism in aggressive carcinoma
Cancer Res.
(2003) - et al.
Midline carcinoma of children and young adults with NUT rearrangement
J. Clin. Oncol.
(2004) - et al.
BRD-NUT oncoproteins: a family of closely related nuclear proteins that block epithelial differentiation and maintain the growth of carcinoma cells
Oncogene
(2008)
Diagnosis of NUT midline carcinoma using a NUT-specific monoclonal antibody
Am. J. Surg. Pathol.
Cited by (17)
Nuclear protein of the testis midline carcinoma in the oral cavity: retrospective review of those initially diagnosed as poorly differentiated squamous cell carcinoma using an anti-C52B1 antibody
2019, International Journal of Oral and Maxillofacial SurgerySinonasal NUT carcinoma: clinicopathological and cytogenetic analysis with autopsy findings
2018, Human PathologyCitation Excerpt :Autopsy findings were also obtained from 2 of the patients. We collected data from the files of 4 patients with NUT carcinoma, of whom 3 were treated at Kanazawa Medical University Hospital between 2010 to 2015, and one received consultation at Iwata Municipal General Hospital (and has already been described in a case report [4]. Further clinical histological and cytogenic analyses, as well as immunohistochemical reviews, were performed in all these cases.
NSD3-NUT-expressing midline carcinoma of the lung: First characterization of primary cancer tissue
2015, Pathology Research and PracticeCitation Excerpt :Immunostaining was performed using DAKO autostainer universal staining system (DAKO, Glostrup, Denmark) with antibodies for the following antigens: CD5 (clone 4C7, 1:150 dilution, DAKO), CD30 (clone Ber-H2, 1:100, DAKO), CD45 (clone 2B11 + PD7/26, 1:150, DAKO), CD56 (clone CD564, 1:100, Leica Biosystems, Newcastle, United Kingdom), CD99 (clone 12E7, 1:100, DAKO), CD138/Syndecan-1 (clone Ml15, 1:100, DAKO), CEA (poly, 1:600, DAKO), chromogranin A (poly, 1:100, DAKO), c-kit (poly, 1:100, DAKO), cytokeratin AE1/AE3 (clone AE1 + AE3, 1:100, DAKO), cytokeratin CAM5.2 (clone CAM5.2, prediluted by manufacturer, Becton, Dickinson and Company, CA, USA), desmin (clone D33, 1:100, DAKO), epithelial membrane antigen (EMA, clone E29, 1:150, DAKO), myogenin (clone F5D, 1:50, DAKO), NUT (C52B1, 1:25, Cell Signaling Technologies Inc., Danvers, MA, USA), p63 (clone 4A4, 1:100, Santa Cruz Biotechnology, Dallas, TX, USA), PLAP (clone 8A9, 1:100, Leica Biosystems), S-100 (poly, 1:1000, DAKO), synaptophysin (poly, 1:150, DAKO), TTF-1 (clone 8G7G3/1, 1:100, DAKO) and vimentin (clone V9, 1:200, DAKO). The FISH procedure was performed as previously reported [17–19]. FISH probes were prepared from the Bacterial Artificial Chromosome (BAC) library.
Translocations and Gene Fusions in Sinonasal Malignancies
2023, Current Oncology ReportsSinonasal NUT carcinoma: A retrospective case series from a single institution
2023, Frontiers in Surgery