Mitochondrial delivery of antisense RNA by MITO-Porter results in mitochondrial RNA knockdown, and has a functional impact on mitochondria
Introduction
Small interfering RNA (siRNA) is frequently used to achieve specific knockdown of target mRNA [1]. Although recent studies have addressed the component of the RNA-induced silencing complex in mitochondria, applications of siRNA to mitochondria have not been reported [2]. On the other hand, this unique organelle possesses not only protein-coding mRNA transcribed from mitochondrial DNA (mtDNA) but also non-coding RNAs such as tRNA, rRNA, and microRNA (miRNA) [3], [4], [5], [6], [7], [8]. It has been reported that miRNAs have the potential to regulate mitochondrial gene expression via a post-transcriptional pathway such as mitochondrial RNA degradosomes [9], [10], [11], [12]. Thus, the knockdown of mitochondrial RNA via the mitochondrial delivery of antisense RNA oligonucleotide (ASO) would be expected to contribute to the development of a mitochondrial therapeutic approach and a more complete understanding of the post-transcriptional regulation.
System for nucleic acids targeted to the cytosol and nucleus have been reported, while less efforts have been expended on mitochondrial delivery systems [1], [13], [14]. Weissig et al. reported that DQAsome, the mitochondriotropic nanocarrier [15], [16], was useful in altering mitochondrial gene expression by virtue of delivering a mini-mitochondrial genome to mitochondria [16]. However, a universal carrier has not yet been developed for mitochondrial matrix delivery, although they reported that an approach using a cationic nanocarrier such as DQAsome could be useful in terms of interacting with mitochondria. Seibel et al. reported that oligo DNA (ODN) and a peptide nucleic acid (PNA) covalently conjugated with the mitochondrial targeting signal peptide (MTS) can be introduced into isolated mitochondria [17], [18]. With the help of a device the cytoplasmic delivery, MTS-conjugated PNA was imported into mitochondria in cells. This method could be a viable strategy for the genetic modification of mitochondria [18]. We recently developed a MITO-Porter system, mitochondrial delivery system via mitochondrial outer membrane fusion [19], [20]. We applied the MITO-Porter system to mitochondrial genome targeting, such as the specific digestion of mtDNA by delivering encapsulated DNase I [21], [22].
In this study, we report on mitochondrial ASO delivery using an R8/GALA-modified MITO-Porter, and validation of mitochondrial RNA knockdown to control mitochondrial function. As shown in Fig. 1A, the R8/GALA-modified MITO-Porter is surface-modified with a high density of octaarginine (R8), which permits the particle to be efficiently internalized by cells via macropinocytosis (1st step) [23]. Once inside the cell, the carrier escapes from the endosome into the cytosol with the assistance of GALA, a pH-sensitive membrane fusogenic peptide (2nd step) [24], [25], [26]. The carrier then binds to mitochondria via electrostatic interactions with R8 (3rd step). In this experiment, we packaged the D-arm modified ASO in the carrier. D-arm is a D stem-loop import signal of tRNATyr(GUA) with the sequence UGGUAGAGC, and is efficiently imported into the mitochondrion of Leishmania, a kinetoplastid protozoan [27]. Oligo nucleic acids constituting D-arm or its analogues can also be imported into the mitochondrial matrix through the mitochondrial inner membrane in isolated mitochondria [28], [29]. Thus, it was expected that D-arm modified ASO encapsulated in the R8/GALA-modified MITO-Porter would facilitate mitochondrial matrix delivery. One possibility is that the MITO-Porter delivers the D-arm ASO to the mitochondrial intermembrane space after fusion with the outer membrane, and it is then imported into the mitochondrial matrix via the D-arm import machinery (upper part in Fig. 1B). An alternate another possibility is that the carriers directly introduce ASO into the mitochondrial matrix via step-wise membrane fusion on the contact sites of the outer and inner mitochondrial membranes (lower part in Fig. 1B).
We first constructed R8/GALA-modified MITO-Porter (D-arm ASO [COX II]), where D-arm modified ASO which targeted mitochondrial mRNA that codes for cytochrome c oxidase subunit II (COX II) was packaged. COX II is one of mitochondrial proteins that make up complex IV of the respiratory chain related to maintaining the mitochondrial membrane potential. If the knockdown of the COX II mRNA was successful, the expression levels of the target mitochondrial protein would be decreased, followed by a decrease in mitochondrial functions such as maintaining membrane potential (Fig. 1C). The knockdown of target mitochondrial mRNA and protein were then evaluated to demonstrate the efficiency of mitochondrial ASO delivery using the R8/GALA-modified MITO-Porter using quantitative reverse transcription PCR (qRT-PCR) and immunostaining. Moreover, we evaluated the mitochondrial membrane potential to investigate the effect of the mitochondrial ASO transfection on mitochondrial function.
Section snippets
Chemicals and materials
1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) and sphingomyelin (SM) were purchased from Avanti Polar lipids (Alabaster, AL). Cholesteryl hemisuccinate (CHEMS) were purchased from Sigma (St Louis, MO). Stearylated R8 and Cholesterol-GALA were obtained from KURABO Industries (Osaka, Japan). D-arm modified antisense 2′ -O-Methyl (2′-OMe) RNA which targeted COX II (D-arm ASO [COX II]) (5′- GGGACUGUAGCUCAAUUGGUAGAGCAUCUUGCGCUGCAUGUGCCAU -3′), D-arm-modified 2′-OMe RNA non-targeting COX II
Construction of R8/GALA-modified MITO-Porter and evaluation of mitochondrial RNA knockdown
We evaluated the knockdown of mitochondrial mRNA, following the mitochondrial ASO delivery by R8/GALA-modified MITO-Porter. In this experiment, we used the D-arm modified antisense 2′-OMe RNA which targeted COX II (D-arm ASO [COX II]) (see Table S1 for details). We prepared R8/GALA-modified MITO-Porter encapsulating D-arm ASO [COX II] and D-arm-modified 2′-OMe RNA non-targeting COX II (D-arm Mock). The diameter, PDI (an indicator of particle-size distribution) and the ζ potential of the
Discussion
The findings reported herein provide a demonstration of the successful mitochondrial delivery and knockdown of target mRNA using a combination of a MITO-Porter system and D-arm ASO [COX II]. As mentioned in the introduction, the D-arm used in this study functions as a mitochondrial tRNA import signal and this sequence is imported into the mitochondrial matrix in mitochondria of Leishmania [27], [28], [29]. Thus, it would be expected that the D-arm would assist mitochondrial matrix delivery,
Conclusion
Our finding constitutes the first report to demonstrate that the nanocarrier-mediated mitochondrial genome targeting of antisense RNA effects mitochondrial function. While, we were unable to determine whether this carrier would be able to achieve the specific knockdown of target mRNA, because the expression levels of all mitochondrial mRNA were not quantified. Further experiments including the validation of off-target effects and advanced function analysis will be required to establish a
Acknowledgement
This work was supported, in part, by the Program for Promotion of Fundamental Studies in Health Sciences of the National Institute of Biomedical Innovation, Japan (NIBIO) (project ID 10-62 to Y.Y.) and by a Grant-in-Aid for Young Scientists (A) (grant 23680053 to Y.Y.) and Scientific Research (S) (grant 22229001 to H.H.) from the Ministry of Education, Culture, Sports, Science and Technology of Japanese Government (MEXT). We thank Milton Feather for his helpful advice in writing the manuscript.
References (38)
- et al.
Mitochondria associate with P-bodies and modulate microRNA-mediated RNA interference
J Biol Chem
(2011) - et al.
Mitochondrial enzyme rhodanese is essential for 5 S ribosomal RNA import into human mitochondria
J Biol Chem
(2010) - et al.
Mitochondria: one of the destinations of miRNAs
Mitochondrion
(2012) - et al.
Human mitochondrial SUV3 and polynucleotide phosphorylase form a 330-kDa heteropentamer to cooperatively degrade double-stranded RNA with a 3'-to-5' directionality
J Biol Chem
(2009) - et al.
RNA degradation in yeast and human mitochondria
Bba Gene Regul Mech
(2012) - et al.
DQAsome-mediated delivery of plasmid DNA toward mitochondria in living cells
J Control Release
(2003) - et al.
Targeted delivery of DNA to the mitochondrial compartment via import sequence-conjugated peptide nucleic acid
Mol Ther
(2003) - et al.
Mitochondrial drug delivery systems for macromolecule and their therapeutic application to mitochondrial diseases
Adv Drug Deliv Rev
(2008) - et al.
MITO-Porter: a liposome-based carrier system for delivery of macromolecules into mitochondria via membrane fusion
Biochim Biophysi Acta
(2008) - et al.
Dual function MITO-Porter, a nano carrier integrating both efficient cytoplasmic delivery and mitochondrial macromolecule delivery
Mol Ther
(2011)
High density of octaarginine stimulates macropinocytosis leading to efficient intracellular trafficking for gene expression
J Biol Chem
GALA: a designed synthetic pH-responsive amphipathic peptide with applications in drug and gene delivery
Adv Drug Deliv Rev
Reprint of: nanoparticles for ex vivo siRNA delivery to dendritic cells for cancer vaccines: programmed endosomal escape and dissociation
J Control Release
A pH-sensitive cationic lipid facilitates the delivery of liposomal siRNA and gene silencing activity in vitro and in vivo
J Control Release
Mitochondrial membrane potential monitored by JC-1 dye
Methods Enzymol
5 S rRNA and tRNA import into human mitochondria. Comparison of in vitro requirements
J Biol Chem
Regulation of mitochondrial respiratory chain biogenesis by estrogens/estrogen receptors and physiological, pathological and pharmacological implications
Biochim Biophys Acta
Mammalian cytochrome-c oxidase: characterization of enzyme and immunological detection of subunits in tissue extracts and whole cells
Methods Enzymol
Lipid-based nanoparticles for siRNA delivery in cancer therapy: paradigms and challenges
Acc Chem Res
Cited by (0)
- 1
The first two authors contributed equally as joint First Authors.